Its Benefits Just think - it could quickly bring help to those who suffer heart attacks or those in diabetic shock. It could even find soldiers kidnapped in Afghanistan or Iraq and lead us straight to terrorist cells. There would be no more kidnapped kids or people anywhere in the world. They could be easily found. Its Horrors But, many Christians wonder if this is also the "mark" pushed on humanity under the ruthless control of a future antichrist - a world dictator who will make Hitler look like a choir boy. All citizens under the antichrist will be forced to take his "mark" in the right hand or forehead in order to buy groceries, see a doctor, or do business in daily life (see Revelation 13:16-17). Those who do take the mark will be subject to God's wrath during the tribulation period and be condemned to hell forever (Rev. 14:9-11). Not good! Malignant Tumors like Prophesy? At first the Verichip looked like only a forerunner of what could later become the infamous tribulation mark. However new information was recently released that sounds suspicious. It turns out that since the 1990s veterinary and toxicology studies show that these implants induce malignant tumors in about 4% of tested animals. It makes us wonder if the chip IS the "mark" we need to avoid. Revelation chapter 16 verse 2 tells us that "painful sores came upon the people who bore the mark …"Below I have uploaded links and info that I referenced in regards to the connection of the mark of the beast in literal form. There is no denying the spiritual and symbolic aspect in revelation, however I am a firm believer their will be a literal aspect as well. I believe God knew in the time it was revealed to John in revelation that people in this generation would look at things from this perspective.
I had heard all the talk of the vaccine and the possible mark of the beast and while i think their were insidious intentions behind it and the pressure they were imposing on the world, it still didn't add up. The vaccine wasn't enough on its own to add up and match the description for the mark. The part my mind couldn't get past was how the forehead would be integrated into this because who would openly put a mark on their forehead? Not to mention how it related to the vaccine and covid-19. So I did what I do best and investigated the depths on the internet and what I found will scare you... My search began with any and all technologies advancing in the near future, particularly involving the head. Look at RFID chips, Vaccines and the FUNVAX vaccine ( a vaccine that effected the part of the brain that religion is associated with), I manage to finally feel like the dots might be connecting. You see I have severe ADHD and I tend to hyper focus. This does mean my brain is like a Ferrari engine and surprisingly my memory for things that interest me is top notch. It was the one thing that made my ADHD seem more like a gift then a curse. upon looking at my research a light bulb went off. Last month (Jan. 2021), The World Economic forum was hosting their Davos agenda summit for the Great reset. You can find this info directly on their website. As I curiously scrolled through their schedule of virtual calls for the week, I noticed one subject stood out as odd to me. The Great reset was a Global agenda to The new world order; so topics included economy, 4th industrial revolution, Covid-19 and the Vaccines, digital currency and leaders from around the world including the UN. But also on the list was Alzheimer's. Alzheimer's, why that? I mean don't get me wrong it is an awful disease that is a growing threat but so is countless other things, so why just that?! Even though my discernment alarms were going off I couldn't see the total picture until last night. I will now share some insight into what I found and summarize at the end...
Looking first at the obvious RFID implant for the hand, I went down the rabbit hole you will see here:
RFIDs offer longer range and ability to be automated, unlike barcodes that require a human operator for interrogation. The main challenge to their adoption is the cost of RFIDs. The design and fabrication of ASICs needed for RFID are the major component of their cost, so removing ICs altogether can significantly reduce its cost. The major challenges in designing chipless RFID is data encoding and transmission.
What is most interesting about the Verichip program was that this was not only the first widespread consumer usage of RFID implants for human identification purposes but was the only FDA approved option. Looking back into this time frame, we can even see the beginning of the "666 - Microchip - Mark of the Beast" mythos. Unfortunately, even today, this myth is spread with the latest incarnation being that of Bill Gates and the Coronavirus Vaccine implants
In March 2004, the Baja Beach Club in Barcelona began a VIP program using the VeriChip as an entry fast pass and bar tab tracker. This program lasted between 2004 and 2008 and is no longer active. Fortunately, some of these chippings were recorded live and uploaded to YouTube. In the video, we can see patrons being implanted in the upper arm; however, later on, individuals would have implants placed in the hand as it was found to be of easier accessibility - this echoing the typical placement of implants today. As well as the Baja Beach Club, Mexican government officials and a family in Florida were recipients. Eventually, however, the VeriChip company would be bought and sold numerous times, and the program would cease operations.
Verichip/VeriMed - the 666 Mark?
Q. Could the "Verichip" implant from Digital Solutions, that Florida company, be the tribulation 666 mark of the beast like you mentioned in another article? (J.M., Mt. Vernon, WA)
Answer:
In 2004 the "Verichip" was FDA approved for use in humans and animals. It makes sense. The computer chip implant could help authorities find lost Alzheimer patients, or help stroke victims. It could find lost pets.
By the way, the latest 2012 version is made by Microsoft. It is called the VeriMed RFID chip.
Its Benefits Just think - it could quickly bring help to those who suffer heart attacks or those in diabetic shock. It could even find soldiers kidnapped in Afghanistan or Iraq and lead us straight to terrorist cells. There would be no more kidnapped kids or people anywhere in the world. They could be easily found. Its Horrors But, many Christians wonder if this is also the "mark" pushed on humanity under the ruthless control of a future antichrist - a world dictator who will make Hitler look like a choir boy. All citizens under the antichrist will be forced to take his "mark" in the right hand or forehead in order to buy groceries, see a doctor, or do business in daily life (see Revelation 13:16-17). Those who do take the mark will be subject to God's wrath during the tribulation period and be condemned to hell forever (Rev. 14:9-11). Not good! Malignant Tumors like Prophesy? At first the Verichip looked like only a forerunner of what could later become the infamous tribulation mark. However new information was recently released that sounds suspicious. It turns out that since the 1990s veterinary and toxicology studies show that these implants induce malignant tumors in about 4% of tested animals. It makes us wonder if the chip IS the "mark" we need to avoid. Revelation chapter 16 verse 2 tells us that "painful sores came upon the people who bore the mark …"
(Again my mind seems to be made for this, I look at the foot labels and it creates another trail for me to research)
Applied Digital Solutions, VeriChip Corp, Digital Angel Corp, Destron Fearing Corp, Xmark Corp And Chameleon-Like Behavior, Tommy G. Thompson's Questionable Link To The VeriChip Corp., FDA And American Medical Association Lend Support To VeriChip, The RU 486 Disaster, FDA And AMA's Serious VeriChip Blunder, FDA AMA And VeriChip Corp. In Denial, VerChip Causes Cancers In Laboratory Mice Rats And Dogs, Mark Of The Beast And Sores, Slow Public Acceptance Of VeriChip RFID Implants, Financial Struggle For VeriChip Corp, VeriChip And Microsoft Join Forces, Biochip Hand Implants A Reality, Somark's Invisible RFID Ink
VeriChip: The FDA Approved Biohack
A lot has changed within biohacking in the last sixteen years. Let's take a look at VeriChip, the only FDA approved human identification RFID implant.
In the '90s the practice of implanting pets with RFID identification microchips became a standard, i.e., Spot gets picked up by animal care and control, Spot's microchip gets scanned providing the veterinarian with an ID number linked to an entry in a database, Spot gets returned to their owner based on that ID number and the information in the connected database. Eleven years later, Dr. Richard Seeling watched 9/11 first responders in New York City write their badge numbers on their arms in marker. *lightbulb moment* A few days later Dr. Seeling implanted a pet RFID microchip in his arm, had no significant complications, and thus the idea of the VeriChip was born.
Jump ahead to 2004 and the VeriChip has been approved by the FDA for use in medical applications. This approval allowing for identity and blood type confirmation, potential allergies, and medical history of unconscious patients. This information was stored on the Global VeriChip Subscriber (GVS) Registry and was linked to the identification number stored on the implant. Same as when lost, Spot was picked up and taken into the vet. There was an initial implant fee, along with a $9.95 subscription fee.
[NOTE THE RAINBOW CIRCLE ON THE BACKDROP BEHIND THEM, THIS IS A CONSTANT CONNECTION WITH THE UN AGENDA 2030]
Microsoft co-founder Bill Gates will launch human-implantable capsules that have ‘digital certificates’ which can show who has been tested for the coronavirus and who has been vaccinated against it. The 64 year old tech mogul and currently the second richest person in the world, revealed this yesterday during a Reddit ‘Ask Me Anything’ session while answering questions on the COVID-19 Coronavirus Pandemic. Gates was responding to a question on how businesses will be able to operate while maintaining social distancing, and said that, “Eventually we will have some digital certificates to show who has recovered or been tested recently or when we have a vaccine who has received it.” The ‘digital certificates’ Gates was referring to are human-implantable ‘QUANTUM-DOT TATTOOS’ that researchers at MIT and Rice University are working on as a way to hold vaccination records. It was last year in December when scientists from the two universities revealed that they were working on these quantum-dot tattoos after Bill Gates approached them about solving the problem of identifying those who have not been vaccinated. The quantum-dot tattoos involve applying dissolvable sugar-based microneedles that contain a vaccine and fluorescent copper-based ‘quantum dots’ embedded inside biocompatible, micron-scale capsules. After the microneedes dissolve under the skin, they leave the encapsulated quantum dots whose patterns can be read to identify the vaccine that was administered. The quantum-dot tattoos will likely be supplemented with Bill Gates’ other undertaking called ID2020, which is an ambitious project by Microsoft to solve the problem of over 1 billion people who live without an officially recognized identity. ID2020 is solving this through digital identity. Currently, the most feasible way of implementing digital identity is either through smartphones or RFID microchip implants. The latter will be Gates’s likely approach not only because of feasibility and sustainability, but also because for over 6 years, the Gates Foundation has been funding another project that incorporates human-implantable microchip implants. This project, also spearheaded by MIT, is a birth control microchip implant that will allow women to control contraceptive hormones in their bodies. As for ID2020, to see it through, Microsoft has formed an alliance with four other companies, namely; Accenture, IDEO, Gavi, and the Rockefeller Foundation. The project is supported by the United Nations and has been incorporated into the UN’s Sustainable Development Goals initiative. It will be interesting to see how Bill Gates and ID2020 will execute all this because many Christians, and surprisingly a growing number of Shia Muslims, are very opposed to the idea of microchipping and any form of body-invasive identification technology. Some Christian legislators and politicians in the United States have even tried to ban all forms of human microchipping. But, on the other hand, this is Bill Gates’ perfect opportunity to see the projects through because as the coronavirus continues to spread and more people continue to die from the pandemic, the public at large is becoming more open to problem-solving technologies that will contain the spread of the virus. The main reason many Christians and some Shia Muslims are opposed to body-invasive identification technologies, however helpful such technologies are for preventing pandemics, is because they believe that such technologies are the so called ‘Mark of Satan’ mentioned in the Bible and some Mahdi prophecies. In the Book of Revelations in the Bible, anyone who does not have this “mark” is not allowed to buy or sell anything. Last year in November, a Denmark-based tech company which had contracts to produce microchip implants for the Danish Government and the US Navy, had to cancel the launch of its supposedly “revolutionary” Internet-of-Things powered microchip implant after Christian activists attacked its offices in Copenhagen.
Animal Tagging: SOMARK’s Chipless RFID Ink Tattoo Field Demo Brings The Company Closer To Launch 2/11/2008
SOMARK Innovations, Inc. recently completed a field demo of its patented Chipless RFID Ink Tattoo animal ID system. The demo proved the SOMARK system’s ability to apply a tattoo in less than three seconds and read the tattoo (translate the tattoo into aunique ID, with a handheld reader in real time). The demo was conducted at a private facility in the U.S.
“This is a giant leap for the company,” said Mark C. Pydynowski, SOMARK President. “This demo proves our system’s ability to function quickly and automatically. Previous tests, which confirmed the technology’s feasibility, were slower and required some tasks to be performed manually.”
SOMARK’s system includes a disposable ink cartridge, a multi-needle applicator and a handheld reader. This technology combines features of several common technologies, including human tattoos (ink-based and inexpensive), chipless RFID (machine-readable and no-line-of-sight), biometrics (unique to the individual) and hot-iron brands (permanent and tamper-proof).
“Although potential applications include cattle, pigs, horses, sheep, dogs, cats, mice, rats and prime cuts of meat, our primary focus is cattle,” said Ramos M. Mays, SOMARK inventor and CSO.
“SOMARK’s technology is distinct because, unlike conventional RFID, it is not constrained by metal, liquid or organic matter,” said Chris D. Justice, SOMARK VP of R&D who joined the company in 2007 after 10 years managing product development, including medical devices. “For example, we can deposit our ink directly on a metal substrate or liquid-filled container and read a unique ID without line-of-sight. Metal compatibility is critical for livestock environments because of the metal laden infrastructure of such facilities.”
About SOMARK Innovations
SOMARK’s purpose is food safety. The technology company is developing a patented ID system based on a biocompatible ink tattoo with chipless RFID functionality. SOMARK is targeting the livestock industry to help identify and track cattle and thus mitigate export trade loss from BSE scares, also known as Mad Cow Disease. SOMARK is located at the Center for Emerging Technologies in St. Louis, MO.
Chief scientist Ramos Mays said the tests provide a true proof-of-principle and mitigate most of the technological risks in terms of the product's performance. "This proves the ability to create a synthetic biometric or fake fingerprint with biocompatible, chipless RFID ink and read it through hair," he said.
Co-founder Mark Pydynowski said during an interview Wednesday that the ink doesn't contain any metals and can be either invisible or colored. He declined to say what is in the ink, but said he's certain that it is 100% biocompatible and chemically inert. He also said it is safe for people and animals.
The process developed by Somark involves a geometric array of micro-needles and a reusable applicator with a one-time-use ink capsule. Pydynowski said it takes five to 10 seconds to "stamp or tattoo" an animal, and there is no need to remove the fur. The ink remains in the dermal layer, and a reader can detect it from 4 feet away.
"Conceptually, you can think of it in the same way that visible light is reflected by mirrors," he said, adding that the actual process is slightly different and proprietary.
The amount of information contained in the ink depends on the surface area available, he said. The U.S. Department of Agriculture calls for a 15-digit number to track cattle. The first three digits are "840" for the U.S. country code. The remaining digits are unique identifiers. The numbers would link to a database containing more information.
Like various existing RFID technologies, chipless RFID tags are associated with a specific RF reader, which questions the tag and recovers the information contained in it. The operating principle of the reader is based on the emission of a specific electromagnetic (EM) signal toward the tag, and the capture of the signal reflected by the tag. The processing of the signal received—notably via a decoding stage—makes it possible to recover the information contained in the tag.[3]
However, chipless RFID tags are fundamentally different from RFID tags. In the latter, a specific frame is sent by the reader[4] toward the tag according to a classic binary modulation schema. The tag demodulates this signal, processes the request, possibly writes data in its memory, and sends back a response, modulating its load.[5] Chipless RFID tags, on the other hand, function without a communication protocol. They employ a grid of dipole antennas that are tuned to different frequencies. The interrogator generates a frequency sweep signal and scans for signal dips. Each dipole antenna can encode one bit. The frequency swept will be determined by the antenna length. They can be viewed as radar targets possessing a specific, stationary temporal or frequential signature. With this technology, the remote reading of an identifier consists of analyzing the radar signature of the tag.
Currently, one of main challenges of the chipless technology is the robustness of tag detection in different environments. It is useless to try to increase the quantity of information that a chipless tag can have if the tag ID cannot be read properly in real environments and without complex calibration techniques. The detection of a chipless tag in noisy environments is much more difficult in chipless than in UHF RFID due to the absence of modulation in time, that is, the absence of two different states in the backscattering signal.
A MUST READ!
Notice that in the above verses, we are told "in their right hand". While this may be mere coincidence, it might interest you to know that the name "Mondex" has some very interesting implications. For example, if we divide it into two syllables, we discover the following:
MON = Latin "moneta" meaning money.
DEX = Latin "dexter" meaning of the right side, right-handed
Another interesting way to look at it is like this:
MONDE = Latin "mundus" meaning the world
X = a mark, as in "X marks the spot".
If Mondex is not the actual mark of the world, the Mark of the Beast, then in my view, it is at least the next step in that direction! These money-hungry and power-hungry worshippers of Satan have now become so sure of themselves, they have become so bold, that it doesn't even bother them to boast about what they are about to do! They have chosen a name which clearly defines their ultimate goal! As I pointed out in "Who is Babylon the Great?", one of the pieces of merchandise of the worldwide commercial system is the spirits and bodies of men; absolute slavery!:
Lately, new research projects, such as European Research Council (ERC) funded project ScattererID,[18] have introduced the paradigm of RF communication system based on chipless labels, where new useful functionalities can be added. With comparable costs to a barcode, these labels should stand out by providing more functionalities than the optical approach. The objective of ScattererID project is to show that it is possible to associate the chipless label ID with other features like the ability to write and rewrite the information, to associate an ID with a sensor function and to associate an ID with gesture recognition.
Biometric inks contain DNA taggants that can be machine read or react to a reading solvent. This allows for verification of a genuine product and each batch of printed documents can contain different biometric properties. These are completely covert but require specialist methods to validate the authenticity.
Blue chip match box reader and retriever
The global Chipless RFID Market 2020 Research report provides information regarding market size, share, trends, growth, cost structure, global market competition landscape, market drivers, challenges and opportunity, capacity, revenue and forecast 2025. This report also includes the overall and comprehensive study of the Chipless RFID market with all its aspects influencing the growth of the market. This report is exhaustive quantitative analyses of the Chipless RFID industry and provides data for making strategies to increase the market growth and effectiveness.
The global Chipless RFID market size is expected to gain market growth in the forecast period of 2020 to 2025, with a CAGR of 20.0% in the forecast period of 2020 to 2025 and will expected to reach USD 2591.1 million by 2025, from USD 1250.3 million in 2019. Top Companies in the Global Chipless RFID Market: AISIN SEIKI, Robert Bosch GmbH, Texas Instruments, Sense A Life, Evenflo Company, Elepho, Mayser GmbH, Flexpoint and others.
This report segments the Chipless RFID market on the basis of Types is:
Tags
Reader
Software
On the basis of Application, the Chipless RFID market is segmented into:
Retail
Supply Chain
Aviation
Healthcare
Smart cards
Public Transit
Others
Regional Analysis For Chipless RFID Market:
For comprehensive understanding of market dynamics, the global Chipless RFID market is analyzed across key geographies namely: North America (United States, Canada and Mexico), Europe (Germany, France, UK, Russia and Italy), Asia-Pacific (China, Japan, Korea, India and Southeast Asia), South America (Brazil, Argentina, Colombia), Middle East and Africa (Saudi Arabia, UAE, Egypt, Nigeria and South Africa).
Smart Chipless Tags : Rethinking the Future of the RFID Market
By Technavio July 6, 2017
As of now, the global chipless RFID market is in the development stage compared to chip embedded systems market. Besides, competition in the industry is intensifying steadily and is characterized by the evolving standards, significant changes in smart technologies, and product launches in line with the customer requirements.
With plenty of advantages that chipless devices deliver and the increased awareness of these benefits, the market is anticipated to witness a surge of new entrants in the coming years. Moreover, at present, Zebra Technologies, Alien Technology, and SATO Vicinity are some of the companies relishing the major stake in the industry.
What is RFID and NFC?
“Radio Frequency IDentification” or RFID is precisely what it says on the tin. Radio frequencies are used to read information from a “tag” that can be either “passive” or “active”. A passive tag has no power source while an active tag is supplied with power, usually from a small battery. The method used to communicate with the tags is referred to as “Near Field Communication” or NFC. The technology is hardly new, and adoption has been accelerating due to lower costs to produce RFID tags along with miniaturization. As far back as 2009, scientists were using RFID tags to note that there is no such thing as realtor ants because realtors add no value, just like human resources:
BIOHAX INTERNATIONAL
Our first company is actually a Swedish startup (no surprise there) that’s turning the “Internet of Things” into the “Internet of Us” with their implantable RFID chip for humans. Founded in 2012, Swedish startup Biohax has taken in an undisclosed amount of funding to develop a hardware product along with workshops and lectures that educate people about “biohacking”. Their RFID tag itself, the NTAG216, is actually made by NXP Semiconductors (NASDAQ:NXPI) with the below specifications:. Biohax then takes these tags, attaches a small antennae to them, and then drops them into a capsule made of bioglass which was approved for use in humans back in 1994. Then, the capsule is injected into the web of skin between the thumb and forefinger. Once that capsule is injected, you simply need to place your hand in near proximity to an NFC enabled device like a smartphone for the data on the tag to be read. That’s it. The obvious use case here is that the tag contains various unique identifiers that can be used to grant access, validate membership, or even provide an address for bitcoins.
With a name like Dangerous Things, our next company is probably less likely to be less of a force behind commercial adoption, but a pioneer nonetheless. Founded in 2013, Seattle based startup Dangerous Things offers “custom gadgetry for the discerning biohacker” so that you can buy a kit like this one and start creating your own use cases:
NTAG216
Why Use RFID Chip in Humans
One important application of implanting these chips in humans, is in the field of medicine. It can be used for storing a person’s medical history. So, if a person is brought into a hospital severely injured or unconscious, it would be extremely useful for the medical practitioner to learn the patient’s medical history, just by using a scanner that recognizes the chip implanted in that person. This useful purpose is why the US Food and Drug Administration allowed implanting these chips in certain people, namely patients suffering from cardiovascular disease, diabetes or Alzheimer’s disease.
DING DING DING!!! LIGHT BULB MOMENT, FULL CIRCLE TO THE GREAT RESET AND ALZHEIMER'S!
BUT IT GETS SCARIER....
Alzheimer's patients, caregivers receiving VeriMed RFID chips
Caring for those with Alzheimer's could be getting a whole lot less stressful, as VeriChip has reportedly doled out 25 VeriMed RFID implantable microchips at the Alzheimer's Community Care 2007 Alzheimer's Educational Conference. Of course, these aren't the first invasive chips that the company has crammed under folks' skin for one reason or another, but these data packin' devices are aiming to provide medical personnel "quick access to identification and medical records information in an emergency situation." Interestingly, not much else was said about future rollouts beyond this small sample trial, but we can't imagine these not showing up en masse (and in humans) once it gets the green light from regulators.
FDA approves pill with sensor that digitally tracks if patients have ingested their medication
New wireless, implantable chip from NCSU could help fight Alzheimer’s, Parkinson’s
RALEIGH – Researchers have developed a chip that is powered wirelessly and can be surgically implanted to read neural signals and stimulate the brain with both light and electrical current. The technology has been demonstrated successfully in rats and is designed for use as a research tool.
“Our goal was to create a research tool that can be used to help us better understand the behavior of different regions of the brain, particularly in response to various forms of neural stimulation,” says Yaoyao Jia, corresponding author of a paper on the work and an assistant professor of electrical and computer engineering at North Carolina State University. “This tool will help us answer fundamental questions that could then pave the way for advances in addressing neurological disorders such as Alzheimer’s or Parkinson’s disease.”
The new technology has two features that set it apart from the previous state of the art.
First, it is fully wireless. Researchers can power the 5×3 mm2 chip, which has an integrated power receiver coil, by applying an electromagnetic field. For example, in testing the researchers did with lab rats, the electromagnetic field surrounded each rat’s cage – so the device was fully powered regardless of what the rat was doing. The chip is also capable of sending and receiving information wirelessly.
The second feature is that the chip is trimodal, meaning that it can perform three tasks.
Current state-of-the-art neural interface chips of this kind can do two things: they can read neural signals in targeted regions of the brain by detecting electrical changes in those regions; and they can stimulate the brain by introducing a small electrical current into the brain tissue.
The new chip can do both of those things, but it can also shine light onto the brain tissue – a function called optical stimulation. But for optical stimulation to work, you have to first genetically modify targeted neurons to make them respond to specific wavelengths of light.
“When you use electrical stimulation, you have little control over where the electrical current goes,” Jia says. “But with optical stimulation, you can be far more precise, because you have only modified those neurons that you want to target in order to make them sensitive to light. This is an active field of research in neuroscience, but the field has lacked the electronic tools it needs to move forward. That’s where this work comes in.”
In other words, by helping researchers (literally) shine a light on neural tissue, the new chip will help them (figuratively) shine a light on how the brain works.
The paper, “A Trimodal Wireless Implantable Neural Interface System-on-Chip,” is published in the journal IEEE Transactions on Biomedical Circuits and Systems. The paper was co-authored by Ulkuhan Guler of Worcester Polytechnic Institute; Yen-Pang Lai of Georgia Tech; Yan Gong, Arthur Weber and Wen Li of Michigan State University; and Maysam Ghovanloo of Bionic Sciences Inc.
The work was done with support from the National Science Foundation (NSF) under grant 2024486. The work was also supported by NC State’s NSF-funded ASSIST Center under grant EEC-1160483. The mission of the ASSIST Center is to create self-powered wearables capable of long-term multi-modal sensing without having to replace or charge batteries.
Technion, Bar-Ilan U. create protein administration chip for Alzheimer's treatment
Alzheimer’s Breakthrough: Brain Implants & Memory Chips?
If the 20th century was defined by the achievements of physics, the 21st century will no doubt be defined by the achievements of biology. To most people, the amazing advances in medical research taking place right now seem like they’re straight out of the pages of a science fiction novel. But there’s nothing fictitious about it – this is the year that human brain implants will bring us one step closer to defeating Alzheimer’s forever.
Brain Prosthetics and Alzheimer’s
The scientist who has been working on this breakthrough for the past two decades is Dr. Theodore Berger of the University of Southern California. Although the science behind it is very complicated, the Berger chip is actually relatively easy to understand. As Alzheimer’s causes to the death of neurons, the brain shrinks, and electrical signals fail to get to where they’re supposed to go. The end result is the memory loss, confusion, and personality changes that characterize Alzheimer’s.
Dr. Berger’s chip circumvents this problem by mimicking the signals of correctly functioning neurons in the hippocampus, the part of the brain hit first and most often by Alzheimer’s. While this technique can’t put memories back in the brain, it does help improve our capability to create and retrieve them. Early tests of the chip have proven to be a roaring success in rats and monkeys, and human trials are already underway.
S cience Fiction is Becoming Science Fact
Earlier this year, DARPA’s chief of biotechnology claimed the advances we’ll see over just the next year will “blow our minds.” And from the little that’s been revealed over the past few weeks, he’s almost certainly right. For example, researchers are currently experimenting with a totally wireless brain-computer interface. By implanting electrodes in paralyzed individuals, scientists have successfully helped paralyzed individuals to manipulate robotic limbs with the use of their minds alone.
These types of advancements might feel like science fiction, but they’re actually becoming increasingly common. It was only a few decades ago that the cochlear implant began to help hundreds of thousands of deaf people to recover their hearing by sending electrical signals directly to their auditory nerves. And human-machine symbiosis is nothing new, as anyone with an artificial hip or knee can tell you.
The Future is Soon for Alzheimer’s Discoveries
Neuroprosthetics are just one of a number of medical advances making their way down the pipe. In Korea, researchers are testing the efficacy of taurine for restoring cognitive function for patients of dementia. In Australia, ultrasound technologyis being tested to try and break up the brain plaques that lead to memory loss. Right here in America, researchers are testing a drug that may be able to slow the development of Alzheimer’s by as much as 30%.
You may have noticed that none of these advances promise to cure Alzheimer’s outright, but cumulatively, they promise progress in treating Alzheimer’s and slowing its march. It may only be a few years until Alzheimer’s is little more than a chronic illness — something that can be made totally manageable with treatment. And while that might sound like science fiction to some people, researchers like Dr. Berger see it only as a matter of time.
Brain chips: Human trials on futuristic implants to enhance memory and treat Alzheimer's begin
Darpa develops brain chip that collects electrical signals and sends them to a computer
Australian scientists funded by the US Defense Advanced Research Projects Agency (Darpa) have developed a transmitter device that can be injected into the brain without invasive surgery and then used to collect electrical signals and then send the data to a computer for analysis, which is a breakthrough in making brain machine interfaces possible.
Researchers from the University of Melbourne have invented the stentrode – a device the size of a paper clip that is basically a tiny stent that comes with an array of electrodes. At the moment, the only way to put electrodes into the brain is to open up the skull during surgery. Instead, the stentrode is flexible enough to be able to pass through the brain via curving blood vessels, yet stiff enough to work properly once it arrives at its destination.
It is inserted into the brain via a blood vessel in the neck and then guided by researchers armed with real-time imaging to a precise location in the brain, where it expands and attaches itself to the walls of the blood vessel in order to read the activity of nearby neurons.
The team, headed by neurologist Thomas Oxley MD of the Vascular Bionics Laboratory, have been working on the neural recording device for the last four years and they were successfully able to implant the stentrode into a freely moving sheep, and then record brain signal readings for up to 190 days after it was implanted.
Their research, entitled "Minimally invasive endovascular stent-electrode array for high-fidelity, chronic recordings of cortical neural activity" is published in the journal Nature Biotechnology.
Next stop, implanting chips in humans
Besides showing that the device would be safe for long-term use, the study also showed that the signal measurements were similar to those taken by surface electrocorticography arrays that are implanted during open brain surgery. The next step would be to trial the brain transmitters in humans in 2017 at the Royal Melbourne Hospital in Australia.
"DARPA has previously demonstrated direct brain control of a prosthetic limb by paralysed patients fitted with penetrating electrode arrays implanted in the motor cortex during traditional open-brain surgery," said Doug Weber, the program manager for Darpa's Reliable Neural-Interface Technology (RE-NET) programme, which is trying to expand and develop the use of brain-machine interfaces to treat physical disabilities and neurological disorders.
"By reducing the need for invasive surgery, the stentrode may pave the way for more practical implementations of those kinds of life-changing applications of brain-machine interfaces."
Interestingly, back in September 2015, IBTimes UK wrote about a book by journalist Annie Jacobsen claiming that Darpa was already embedding such computer chips into the brains of injured soldiers coming back from the Middle East with the intent to help treat the disorders, and a PowerPoint slide describing the how the system would work was leaked onto the internet.
When we published the story, we were contacted by Darpa, who insisted that they were not implanting chips into the brains of humans, yet they did not call Jacobsen's book a lie. But with this new research endorsed by Darpa, it seems clear that there is definitely something going on, and Darpa definitely wants to connect the human brain to a computer.
In August 2014, President Obama unveiled 19 plans he was enacting to improve the mental health of US soldiers and veterans. One of the plans included developing computer chips that could be implanted within the brain's tissue to help regulate the nervous system, which would help to alleviate symptoms of a variety of conditions from post-traumatic stress disorder (PTSD) to arthritis.
Before this, in May 2014 the Pentagon had announced that it was working to develop these brain computer chips using a $12m (£7.9m) grant that was part of a huge overarching $78.9m research program into building "new, minimally invasive neurotechnologies" to help the brain and body heal faster.
According to Defense One, the Pentagon said that Darpa hoped to develop a prototype for the chip within five years and then seek approval from the US Food and Drug Administration (FDA).
DARPA Cortical Modem connects brain directly to computer for 'electronic telepathy and telekinesis'
brain-computer interface has been developed by the US Defence Research Projects Agency (DARPA) that is capable of laying a heads-up display over a user's natural vision.
The "cortical modem" also holds the potential to cure sight loss and enable "electronic telepathy and telekinesis" according to noted futurist Peter Rothman, writing for H+ Magazine.
While still a long way from production, the direct neural interface (DNI) chip would be shaped like a coin, around 1cm wide, and could conceivably cost as little as $10 (£6.50).
As outlined at the Biology is Technology conference in Silicon Valley last week, the interface provides a direct link between the brain and an external device or software through manipulation of the visual cortex.
Phillip Alvelda, chief of DARPA's Biological Technologies, told the conference how the device could replace all virtual reality glasses, such as the Oculus Rift, by bypassing the visual sensory system entirely
The project builds on the work of Karl Deisseroth in the field of optogenetics, according to H+ Magazine which was in attendance at the California conference.
Optogenetics involves the controlling of light-responsive proteins within the brain through targeted light emission.
DARPA has led the way in a number of futurist and transhumanist projects, including a tiny implant that assists the body's organs in healing themselves when injured.
The secretive agency was established by the US Government in 1958 in response to the launch of Sputnik by the USSR.
DARPA described its purpose in a 2005 document as follows: "DARPA's original mission, established in 1958, was to prevent technological surprise like the launch of Sputnik, which signalled that the Soviets had beaten the US into space.
The mission statement has evolved over time. Today, DARPA's mission is still to prevent technological surprise to the US, but also to create technological surprise for our enemies."
Role
The hippocampus is part of the human limbic system, which interacts with the neocortex and other parts of the brain to produce emotions.[1] As a part of the limbic system, the hippocampus plays its part in the formation of emotion in addition to its other roles, such as consolidation of new memories, navigation, and spatial orientation.[2] The hippocampus is responsible for the formation of long term recognition memories. In other words, this is the part of the brain that allows us to associate a face with a name. Because of its close relationship with memory formation, damage to the hippocampus is closely related to Alzheimer's disease.
Anatomy
For more anatomical information, see Hippocampus anatomy.
The hippocampus is a bilateral structure, situated under the neocortex. Each hippocampus is "composed of several different subsystem[s] that form a closed feedback loop, with input from the neocortex entering via the entorhinal cortex, propagating through the intrinsic subregions of the hippocampus and returning to the neocortex." In an electronic sense, the hippocampus is composed of a slice of parallel circuits.
https://www.bgp4.com/2018/11/26/darpa-cortical-modem-connects-brain-directly-to-computer-direct-neural-interface-dni-chip/
Brain Computer Interface – Future & Present
Brain computer interface market 2020 is expected to gain a quick mileage. The communication pathway paved between a wired brain and an external device is referred to as brain computer interface. It is also commonly known as neural-control interface (NCI), direct neural interface (DNI), mind-machine interface (MMI), or brain-machine interface (BMI). The electrodes that help in reading the signals of a human brain are studied in this process. Well, the technology has been witnessing numerous research & development activities and has the potential to revolutionize the technology sector entirely. At present, there are three kinds of BCI – invasive type, partially invasive type, and non-invasive type. The developments in human machine interface technologies are supposed to experience a rise in applications over the next couple of years.
Applications of Brain Computer Interface
Brain computer interface technologies are gaining traction of the healthcare industry. Imaging technologies such as electroencephalography and NRI has been integrated with braincomputerinterface for diagnosing and curing disorders such as Alzheimer’s, paralysis, cerebral palsy, dementia, vision impairment, hearing impairment, etc. Brain computer interface application is not restricted to this one particular industry. It has already found applications in other industry domains such as defense & aerospace and education & research.
The devices used in the process are sensors and electrodes that are placed in the grey matter of the brain. Thus, the developments of the sensor technology are also supposed to play a crucial role in widening the application base of brain-machine interface. Also, the technological innovations in end-user industries are supposed to open avenues of BCI adoption in the years to come. Also, increasing prevalence of brain disorders is anticipated to catalyze the investments in research & development.
Future Prognosis of Brain Computer Interface Market
Some of the core brain computer interface companies are – Emotiv, NeuroSky, Inc, MindMaze, Natus Medical Incorporated, Nihon Kohden Corporation, Brain Products GmbH, Advanced Brain Monitoring, Inc, Compumedics Limited, g.tec, BrainCo, Inc., and Neuroelectrics. With the development of the technology, which is inevitable, new players are supposed to enter the market. According to the brain computer interface report offered by Market Research Future (MRFR), Brain Computer Interface Market is supposed to strike 15.1% CAGR over the forecast period 2019 to 2024.
Geographically, North America holds around 50% of the market share. The advancements in technology of the region have facilitated the growth of the market. The infrastructure of the end-user verticals in the region is quite developed to support the adoption of BCI and its developments. Thus, the region is expected to continue growing at a fast pace over the next couple of years. Europe, in terms of technological infrastructure, exhibits developments too. It is also anticipated to experience considerable rate of growth in the coming years. According to MRFR’s observations, the Europe market was valued at USD 265.4 Mn in 2017. It is assessed to trail North America market closely. Asia Pacific, too, is expected to grow substantially. The regional market is observing a rise in inflow of investments.
Drawbacks
Cybersecurity remains a major concern. Imagine what would a rival nation pay to get the information about the information about a leader? Thus, advancements in data security are expected to pave the way for higher adoption of the technology. Till then, the road map is likely to remain untapped of its full potential.
Key Developments
In December 2018, Brain Products GmbH launched actiCHamp Plus. This offers a scalable and flexible solution for laboratory EEG recordings. This instrument offers active and passive electrode recordings.
In October 2017, Natus Medical Incorporated acquired neurosurgery business assets of Integra Life Sciences Corporation, i.e., acquisition of the global Camino ICP monitoring product line, including its San Diego manufacturing facility and others.
In October 2018, EMOTIV partnered with SAP SE to develop a user experience (UX) solution for improving productivity using mobile neurotechnology. The companies are focusing on providing hands-free interaction with machines.
In June 2018, Neurosky, Inc. launched MindWave Mobile 2 EEG headset, to understand the activity of the brain. These headsets are similar to the company’s previous offering, a headset named MindWave Mobile Plus. Both the headsets work on the same technology, though they differ in characteristics.
In September 2017, Nihon Kohden Corporation launched the CerebAir EEG headset for continuous study of brain functionality and activities. The product was manufactured as a user-friendly device that can be operated by anyone.
In June 2016, Google added three security tools, namely, security sandbox, advanced phishing and malware protection, and Gmail confidential mode to Gmail. These tools would enhance security to protect users from potential threats to the system.
SO BY NOW WE ALL KNOW ELON MUSK'S NEURAL LINK; FOR ALL I KNOW THIS IS IT HOWEVER I THINK EVEN MORE LITERAL, THE FOREHEAD NOT THE SIDE OF THE BRAIN NOT THE BACK BUT THE FRONT!
The mammalian prefrontal cortex comprises a set of highly specialized brain areas containing billions of cells and serves as the centre of the highest-order cognitive functions, such as memory, cognitive ability, decision-making and social behaviour1,2. Although neural circuits are formed in the late stages of human embryonic development and even after birth, diverse classes of functional cells are generated and migrate to the appropriate locations earlier in development. Dysfunction of the prefrontal cortex contributes to cognitive deficits and the majority of neurodevelopmental disorders; there is therefore a need for detailed knowledge of the development of the prefrontal cortex. However, it is still difficult to identify cell types in the developing human prefrontal cortex and to distinguish their developmental features. Here we analyse more than 2,300 single cells in the developing human prefrontal cortex from gestational weeks 8 to 26 using RNA sequencing. We identify 35 subtypes of cells in six main classes and trace the developmental trajectories of these cells. Detailed analysis of neural progenitor cells highlights new marker genes and unique developmental features of intermediate progenitor cells. We also map the timeline of neurogenesis of excitatory neurons in the prefrontal cortex and detect the presence of interneuron progenitors in early developing prefrontal cortex. Moreover, we reveal the intrinsic development-dependent signals that regulate neuron generation and circuit formation using single-cell transcriptomic data analysis. Our screening and characterization approach provides a blueprint for understanding the development of the human prefrontal cortex in the early and mid-gestational stages in order to systematically dissect the cellular basis and molecular regulation of prefrontal cortex function in humans.
PRODUCING VISIONS
In fact, some of the same brain regions involved in the pie experience create religious experiences, too. When the image of a cross, or a Torah crowned in silver, triggers a sense of religious awe, it is because the brain’s visual-association area, which interprets what the eyes see and connects images to emotions and memories, has learned to link those images to that feeling. Visions that arise during prayer or ritual are also generated in the association area: electrical stimulation of the temporal lobes (which nestle along the sides of the head and house the circuits responsible for language, conceptual thinking and associations) produces visions.
Temporal-lobe epilepsy-abnormal bursts of electrical activity in these regions-takes this to extremes. Although some studies have cast doubt on the connection between temporal-lobe epilepsy and religiosity, others find that the condition seems to trigger vivid, Joan of Arc-type religious visions and voices. In his recent book “Lying Awake,” novelist Mark Salzman conjures up the story of a cloistered nun who, after years of being unable to truly feel the presence of God, begins having visions.
The cause is temporal-lobe epilepsy. Sister John of the Cross must wrestle with whether to have surgery, which would probably cure her-but would also end her visions. Dostoevsky, Saint Paul, Saint Teresa of Avila, Proust and others are thought to have had temporal-lobe epilepsy, leaving them obsessed with matters of the spirit.
Although temporal-lobe epilepsy is rare, researchers suspect that focused bursts of electrical activity called “temporal-lobe transients” may yield mystical experiences. To test this idea, Michael Persinger of Laurentian University in Canada fits a helmet jury-rigged with electromagnets onto a volunteer’s head.
The helmet creates a weak magnetic field, no stronger than that produced by a computer monitor. The field triggers bursts of electrical activity in the temporal lobes, Persinger finds, producing sensations that volunteers describe as supernatural or spiritual: an out-of-body experience, a sense of the divine. He suspects that religious experiences are evoked by mini electrical storms in the temporal lobes, and that such storms can be triggered by anxiety, personal crisis, lack of oxygen, low blood sugar and simple fatigue-suggesting a reason that some people “find God” in such moments. Why the temporal lobes? Persinger speculates that our left temporal lobe maintains our sense of self. When that region is stimulated but the right stays quiescent, the left interprets this as a sensed presence, as the self departing the body, or of God.
THE NEURAL BASIS FOR RELIGIOUS EXPERIENCE
That dissociation may reflect unusual electrical crackling in one or more brain regions. In 1997, neurologist Vilayanur Ramachandran told the annual meeting of the Society for Neuroscience that there is “a neural basis for religious experience.” His preliminary results suggested that depth of religious feeling, or religiosity, might depend on natural-not helmet-induced-enhancements in the electrical activity of the temporal lobes.
Interestingly, this region of the brain also seems important for speech perception. One experience common to many spiritual states is hearing the voice of God. It seems to arise when you misattribute inner speech (the “little voice” in your head that you know you generate yourself) to something outside yourself. During such experiences, the brain’s Broca’s area (responsible for speech production) switches on. Most of us can tell this is our inner voice speaking. But when sensory information is restricted, as happens during meditation or prayer, people are “more likely to misattribute internally generated thoughts to an external source,” suggests psychologist Richard Bentall of the University of Manchester in England in the book
SO WOULDNT IT MAKE SENSE THAT SATAN WAS TRYING TO BLOCK OUR PART OF THE BRAIN THAT SPEAKS TO GOD!
I suggest watching this video it is truly terrifying what he speaks of, humans have gone too far...
Steven Hoffman
Brain Computer interface technology opens up a world of possibilities. We are on the cusp of this technology that is so powerful and has the potential to so radically transform our lives and existence! After starting three venture-funded startups in Silicon Valley, Steven Hoffman, known as Captial Hoff, launched Founders Space with the mission to educate and accelerate entrepreneurs and intrapreneur. Founder Space has become one of the top startup accelerators in the world with over 50 partners in 22 countries. This talk was given at a TEDx event using the TED conference format but independently organized by a local
AND THIS IS WHERE WE FIND THE FINAL LINK HAT I CAN CURRENTLY PERCIEVE,
OPTOGENETICS IF FRONTAL LOBE TECH THAT EMITS LIGHT INTO THE BRAIN AND CAN CONTROL YOUR BRAIN IN EVERY WAY, CURE ANY BRAIN DISFUNCTION AND ALL YOUR MEMORIES, EMOTIONS, AND CAN EVEN IMPLANT NEW ONES.
Optogenetics (from Greek optikós 'seen, visible') most commonly refers to a biological technique that involves the use of light to control neurons that have been genetically modified to express light-sensitive ion channels. As such, optogenetics is a neuromodulation method that uses a combination of techniques from optics and genetics to control the activities of individual neurons in living tissue—even within freely-moving animals.[1] In some usages, optogenetics also refers to optical monitoring of neuronal activity[1] and control of biochemical pathways in non-neuronal cells,[2] although these research activities preceded the use of light-sensitive ion channels in neurons.[3][4] As optogenetics is used by some authors to refer to only optical control of the activity of genetically defined neurons and not these additional research approaches,[5][6][7] the term optogenetics is an example of polysemy.
Neuronal control is achieved using optogenetic actuators like channelrhodopsin, halorhodopsin, and archaerhodopsin, while optical recording of neuronal activities can be made with the help of optogenetic sensors for calcium (GCaMPs), vesicular release (synapto-pHluorin), neurotransmitters (GluSnFRs), or membrane voltage (Quasars, ASAPs, Archons).[8][9] Control (or recording) of activity is restricted to genetically defined neurons and performed in a spatiotemporal-specific manner by light.
In 2010, optogenetics was chosen as the "Method of the Year" across all fields of science and engineering by the interdisciplinary research journal Nature Methods.[10] At the same time, optogenetics was highlighted in the article on "Breakthroughs of the Decade" in the academic research journal Science
OH AND IT REQUIRES A VIRUS VECTOR,
Virus-Based Optogenetics Provides On and Off Switches for Pain
Light activates or inhibits nociceptors in freely moving non-transgenic mice
by Summer Allen on 3 Mar 2014
Optogenetics—the use of light-sensitive ion channels to regulate neuron activity—is a powerful method that has only recently been used to probe the transmission of pain signals. But thus far, most optogenetic studies have required the production of transgenic mice—a process that is costly and takes a long time. A new technique from Scott Delp and colleagues at Stanford University, US, removes this requirement and offers additional benefits: It can either activate or inhibit pain in freely moving mice. Delp’s research team described the technique and its use in a mouse model of chronic pain in a study published online on February 16 in Nature Biotechnology. In the study, Delp and colleagues used an adenovirus to introduce light-sensitive channels into nociceptors. After injecting adeno-associated virus 6 (AAV6) engineered to express the blue light-sensitive cation channel channelrhodopsin-2 (ChR2) into one side of the sciatic nerve in wild-type mice, they found ChR2 expression in unmyelinated nociceptors that project to lamina I/IIo of the spinal cord. Shining a blue light on the mouse’s paw activated ChR2 and caused the animal to flinch and lick its paws, indicating a pain response. Lower intensity blue light did not induce pain behavior, but made the mice sensitive to normally inoffensive levels of thermal and mechanical stimulation. Additionally, the mice developed an aversion to low levels of blue light and, when given a choice, would avoid entering cage areas illuminated with blue light. Next, the researchers asked if they could use optogenetics to make mice less sensitive to touch and heat. To test this, they used AAV6 encoding the yellow light-sensitive chloride pump halorhodopsin (NpHR)—an opsin that turns off neuronal activity. When exposed to yellow light, mice injected with this virus became less sensitive to both thermal and mechanical stimulation. According to graduate student Shrivats Iyer, one of the lead authors of the study, “to our knowledge, this is one of the first demonstrations of optogenetic inhibition of nociceptor activity that has been published.” The group took this finding one step further and used the NpHR virus in a mouse model of chronic pain. Mice with a chronic constriction injury of the sciatic nerve (CCI) develop hypersensitivity to mechanical and thermal stimulation, but CCI mice injected with the NpHR virus did not show this hypersensitivity when a yellow laser was used to activate the opsin. According to Philippe Séguéla, McGill University, Montreal, Canada, who was not part of the study, the “effects reported are striking.” AAV6-transduced expression of the inhibitory halorhodopsin NpHR overlaps with nociceptive markers in DRG neurons. NpHR, green; calcitonin gene-related peptide (CGRP) or isolectin-B4 (IB4) markers, magenta; overlap, white. Credit: Iyer and Montgomery. This technique shares some similarities with previously published work—for example, a study by Séguéla’s group used optogenetics to activate pain behaviors in freely moving transgenic mice (see PRF related news story). But the new technique’s ability to decrease a mouse’s sensitivity to thermal and mechanical stimuli makes it unique—as does its viral approach. Iyer said that the virus’ quick action is a big advantage: “You can give a mouse an injection and within two weeks achieve opsin expression.” This compares well to transgenic optogenetic mice, which take several months or even years to make. Séguéla agreed that speed is a major advantage of the technique, and also noted that “the approach is likely not restricted to mice” and could possibly “be applied to rats and non-human primates.” According to graduate student Kate Montgomery, who was also a lead author of the study, the viral approach offers other advantages: “We wanted to develop a system that was modular so it could be changed by different neuroscientists who want to target different cell populations or want to use different opsins.” She said this is particularly important, as new opsins are constantly being developed.
SO WHAT IF THE COVID VAX IS THE FIRST STEP NEEDED TO IMPLEMENT AN IMPLANT TO CONTROL YOUR THOUGHTS?
DOES THIS SOUND CRAZY? WELL WHEN YOU SEE WHAT IS NEEDED YOU WONT THINK SO...
Applications of LMOs
We are interested in the relationship between neuronal activity and shaping of neuronal circuitry resulting in the spectrum of “normal” to “abnormal” behavior. To this end we study the effect of early postnatal neuronal hyper-excitation or hyper-inhibition on adult behavior. These experiments utilize mice genetically engineered to conditionally express luminopsins in defined neuronal populations.
We are also testing if we can utilize experimenter-induced neuronal activity to intervene in the neurodegenerative decline of brain function. Here we study the effect of neuronal excitation on alleviating motor defects in Parkinson’s disease. In these experiments we transplant neuronal stem cells expressing luminopsins into the brain of a genetic mouse model of Parkinson’s disease.
Furthermore, we are exploring the potential therapeutic effects of experimentally manipulated neuronal activity in regenerating injured neuronal circuits. Specifically, we are assessing the effects of stimulating luminopsin expressing spinal cord neurons following spinal cord injury in a rat model.
“NeuroNex Neurotechnology Hub: Bioluminescence for optimal brain control and imaging” Collaboration with Christopher Moore (Brown University, Providence RI), Diane Lipscombe (Brown University, Providence RI) & Nathan Shaner (UC San Diego, San Diego, CA)
pAAV:cTNT::Luciferase
Vector backbone AAV2/9.cTnT.PI.EGFP.RBG (Search Vector Database)
Backbone manufacturer Penn Vector Core
Backbone size w/o insert (bp) 4405
Total vector size (bp) 6047
Vector type AAV
Growth in Bacteria
Bacterial Resistance(s) Ampicillin
Growth Temperature 37°C
Growth Strain(s) Stbl2
Growth instructions The plasmid will easily get mutated if bacterial cultured too long. Using SmaI to do a diagnose digestion is recommended.
Copy number High Copy
Gene/Insert
Gene/Insert name Firefly luciferase
Species Firefly
Insert Size (bp) 1653
GenBank ID Nuleotide> U47295
Promoter Chicken cardiac troponin T
Cloning Information
Cloning method Restriction Enzyme
5′ cloning site NheI (not destroyed)
3′ cloning site NotI (not destroyed)
5′ sequencing primer CCAATAGAAACTGGGCTTGTC
3′ sequencing primer CCAGAAGTCAGATGCTCAAG
(Plasmid #69915)
This plasmid contains chicken cardiac tromonin T promoter. When packaged into AAV9 virus using the AAV 2/9 Rep/Cap plasmid, the AAV9:cTNT.Luciferease virus will easily transduce the neonatal mouse. This virus does not work in vitro cultured cardiomyocytes.
Bioluminescence for Optimal Brain Control and Imaging
Bioluminescence (BL) is common in nature, especially in the ocean, and evolved many times for a variety of behaviors including prey capture, mate attraction, and self-defense. Light production occurs when a small molecule (luciferin) binds an enzyme (luciferase) and produces photons. This chemical form of light generation has many potential advantages for imaging brain activity and neural control.
Plasmid #101139 Purpose Luciferase reporter plasmid. Note that both renilla luciferase and ORF-firefly luciferase are encoded by a single mRNA and both are translated independently via internal ribosomal binding sites. Depositor William Kaelin
The first system allowing light control of transcription, involving use of a plant photoreceptor interaction to bring together a split Gal4 transcription factor, was developed over a decade ago in yeast (4). Since then, a variety of systems based on engineered or natural light-sensitive photoreceptor proteins have emerged for use in higher eukaryotes (5–12). While existing systems are being broadly adopted, efficacy and background vary considerably in different organisms and cell types, with no single system showing ideal properties across all applications.
Cryptochrome 2 (CRY2) and CIB1 are Arabidopsis proteins that dimerize upon exposure to blue light (13,14). Previously, we used these modules to develop a system to regulate transcription in yeast, using blue light to reconstitute a split transcription factor through CRY2–CIB1 binding (14–16). Attempts by our group or others (7,8,17) to adapt this system for transcriptional control in higher eukaryotes have suffered from poor light-stimulated activity or high basal activity in dark. While our original system in yeast fused CRY2 to a DNA binding domain and CIB1 to an activation domain, other studies fused CIB1 to a DNA binding domain (8,17). Because CIB1 is itself a transcriptional activator (7,13), the CIB1-BD fusion can activate transcription on its own without CRY2–CIB1 association, and thus can result in increased dark background activity.
Quantitative RT-PCR
Total RNA was prepared using TRI reagent (Molecular Research Center) following the manufacturer's protocol. RNA was verified by calculation of OD280/260 ratio using an Eppendorf spectrophotometer. To remove genomic DNA, total RNA was treated with RQ1 RNAse free DNAse (Promega). High Capacity cDNA Archive Kit (Applied Biosystems) was used to synthesize cDNA from DNAse-treated total RNA (2 μg of total RNA) using random hexamers. Quantification of firefly luciferase mRNA and mCherry mRNA (internal control) was performed on Applied Biosystems 7300 real-time PCR system using Power SYBR Green Master Mix (Applied Biosystems). Samples were run in triplicate, and the average cycle threshold (CT) was calculated. The average luciferase CT value for each sample was normalized to the corresponding average mCherry CT value to obtain a ΔCT value. The fold change in luciferase mRNA expression relative to reporter only samples was calculated using the comparative CT (ΔΔCT) values. Primer sequences used for firefly luciferase were 5′-GCTATTCTGA TTACACCCGA GG-3′ and 5′-TCCTCTGACA CATAATTCGC C-3′ and for mCherry were 5′-CACTACGACG CTGAGGTCAA-3′ and 5′-GTAGTCCTCG TTGTGGGAGG-3′.
Bioluminescence-Driven OptogeneticsMaciàSureda-Vives1,2and Karen S. Sarkisyan1,2,3,*1Synthetic Biology Group, MRC London Institute of Medical Sciences, London W12 0NN, UK;m.sureda-vives17@imperial.ac.uk2Institute of Clinical Sciences, Faculty of Medicine, Imperial College London, London W12 0NN, UK3Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,Moscow 117997, Russia*Correspondence: karen@ibch.ru or k.sarkisyan@lms.mrc.ac.ukReceived: 9 November 2020; Accepted: 25 November 2020; Published: 28 November 2020Abstract:Bioluminescence-based technologies are among the most commonly used methods toquantify and visualise physiology at the cellular and organismal levels. However, the potential ofbioluminescence beyond reporter technologies remains largely unexplored. Here, we provide anoverview of the emerging approaches employing bioluminescence as a biological light source thattriggers physiological events and controls cell behaviour and discuss its possible future application insynthetic biology.Keywords:bioluminescence; optogenetics; BRET; synthetic biology; luciferase; luciferin; luminopsin;photosensitiser; light-based communicati
file:///C:/Users/templ/AppData/Local/Temp/life-10-00318.pdf
Optogenetic control of mRNA localization and translation in live cells
Translation is the process of transferring genetic information from mRNA to protein. Numerous studies have demonstrated that mRNA translation is tightly related to mRNA localization. However, conventional methods are insufficient to fully address which mRNA molecules are responsible for which aspects of a given cellular event. To directly investigate the causal relationship between the translation of specific mRNAs and various biological processes, Professor Won Do Heo’s research group developed an optogenetic method to achieve space and time resolved control of specific molecules in live cells.
Figure 2. Schematic for mRNA-LARIAT-mediated sequestration of mRNAs. In the presence of blue light, a complex of proteins traps the target mRNA, blocking it into a cluster. Each module mRNA-LARIAT has a function: CRY2-VhH(GFP) is sensitive to blue light and emits green light, CIB1-MP promotes the formation of the cluster, and Rcas9-GFP interacts with the mRNA produced by the cell and emits green light.
Na Yeon Kim*, Sangkyu Lee*#, Nury Kim, Hyerim Park and Won Do Heo.
Optogenetic control of mRNA localization and translation in live cells.
Nature Cell Biology. 2020 Feb 17. doi: 10.1038/s41556-020-0468-1.
Highlighted by Nature Reviews Genetics.
Web address for full article : https://www.nature.com/articles/s41556-020-0468-1
AND THIS COMPANY IS CALLED SOUL OF ALL THINGS:
Optogenetics with SOUL
The Feng lab has developed a next-generation optogenetic system for non-invasive stimulation of neurons. Sabbi Lall|McGovern Institute for Brain Research Publication Date: May 7, 2020
Engineering with light
In order to stimulate neurons with minimal invasiveness, Feng and colleagues engineered a new type of opsin. The original breakthrough optogenetics protocol used channelrhodopsin, a light-sensitive channel discovered in algae. By expressing this channel in neurons, light of the right wavelength can be used to activate the neuron in a dish or in vivo. However, in vivo application requires the implantation of optical fibers to deliver the light close to the specific brain region being stimulated, especially if the target region is in the deep brain. In addition, if the neuron being targeted is in the deep brain, it is hard for light to reach the region in the absence of invasive tools that can damage tissue and impact the behavior of the animal.
This new study creates a method that can activate any mouse brain region, independent of its location, non-invasively.
“Prior to our study, a few studies have contributed in various ways to the development of optogenetic stimulation methods that would be minimally invasive to the brain. However, all of these studies had various limitations in the extent of brain regions they could activate,” says co-senior study author Robert Desimone, director of the McGovern Institute and the Doris and Don Berkey Professor of Neuroscience at MIT.
Probing the brain with SOUL
Feng and colleagues turned instead to new opsins, in particular SOUL, a new type of opsin that is very sensitive to even low-level light. The Feng group engineered this opsin, based on SSFO, a second-generation optogenetics tool, to have increased light sensitivity, and took advantage of a second property: that SOUL is activated in multiple steps, and once activated, it stays active for longer than other commonly used opsins. This means that a burst of a few seconds of low-level light can cause neurons to stay active for 10-30 minutes.
In order to put SOUL through its paces, the Feng lab expressed this channel in the lateral hypothalamus of the mouse brain. This is a deep region, challenging to reach with light, but with neurons that have clear functions that will lead to changes in behavior. Feng’s group was able to turn on this region non-invasively with light from outside the skull, and cause changes in feeding behavior.
“We were really surprised that SOUL was able to activate one of the deepest areas in the mouse brain, the lateral hypothalamus, which is 6 millimeters deep,” explains Feng.
But there were more surprises. When the authors activated a region of the primate brain using SOUL, they saw oscillations, waves of synchronized neuronal activity coming together like a choir. Such waves are believed to be important for many brain functions, and this result suggests that the new opsin can manipulate these brain waves, allowing scientists to study their role in the brain.
The authors are planning to move the study in several directions, studying models of brain disorders to identify circuits that may be suitable targets for therapy, as well as moving the methodology so that it can be used beyond the superficial cortex in larger animals. While it is too early to discuss applying the system to humans, the research brings us one step closer to future treatment of neurological disorders.
The Genetics of the Deception
Restriction Enzymes
Recombinant DNA
The technology known as recombinant DNA in fact now makes it possible for a grown man or woman to be altered at the genetic level. If a non-human gene were introduced into the human genome then the person would no longer be fully human but would by definition become a hybrid. The ancient name for a creature that is composed of different kinds is known as a chimera and that is also the name given to hybrid creatures by scientists today. We considered some strange creatures in a previous chapter such as the spider goat and the green glowing pigs to name a few.
Recombinant DNA is “hybrid DNA that has been created from more than one source.”[i] The basic procedure is where a DNA strand is opened up and then a gene from another organism is inserted making a new strand of DNA. Then the RNA replicates the new strand and it is passed into the entire system. “When recombinant DNA is then further altered or changed to host additional strands of DNA, the molecule formed is referred to as “chimeric” DNA molecule, with reference to the mythological chimera that consisted as a composite of several animals.”[ii] By means of recombinant DNA, Satan may be able to convince humanity to insert demonic genes, perceived as desirable, into the human genome. The genetic composition of the person, therefore, would result in that person becoming a chimera.
DAYS OF NOAH (NEPHILLIM)
His Mark
Also it [the image of the beast] causes all, […] to be marked on the right hand or the forehead, so that no one can buy or sell unless he has the mark, that is, the name of the beast or the number of its name. This calls for wisdom: let the one who has understanding calculate the number of the beast, for it is the number of a man, and his number is 666, (Revelation 13:16-18).
Transhumanist and end-times researcher Tom Horn has written a great deal about the coming consequences of man changing himself at the source code level.[iv] Horn’s wife Nita has suggested that recombinant DNA (RDNA) may be the means by which the mark of the beast is introduced onto an unsuspecting world[v] through the rewriting of one’s DNA to so that the person is no longer fully human but is part beast (Antichrist).[vi] The suggestion appears valid in light of all that we have learned.
He will obtain Satan’s own genetic material and then insert it into his body using Recombinant DNA. His body’s own RNA will then cause the Satanic strain to be replicated into various parts of his body and once completed, his genetic make-up (DNA) will be a new code – a code not strictly from Adam (even in Adam’s fallen state), but will be augmented code that has been mixed with the Satan just as God declared in Genesis 3:15. Satan will have finally succeeded in imitating the incarnation. This man will literally become the genetic son of Satan because he will have Satan’s seed mingled in with his own. This conclusion fulfills Genesis 3:15 plus it is consistent with what other fallen angels did in Noah’s day. It is consistent with Daniel 2:43 and also explains how the Little Horn rises up to where the other horns are and how he is able to cast them to the ground. It is consistent with the technology of transhumanism in that dissimilar kinds can now be mingled and is also consistent with the research of John Mack and David Jacobs and the “aliens” want to create a hybrid race. Lastly, it squares with the expectation that “aliens […] will select a human person and endow him with superhuman powers and knowledge. This man will lead us to world government and world peace.”[vii]
It is reasonable and probably that the mark of the Beast will also be an imitation of what the Lord wants to do for believers – He will restore us spiritually and genetically – we will be like him, we will be in his image, we will be conformed to his glorious body we will have God’s seed in us. By Satan giving his genetic material to the Beast (who “replaces” Jesus) and then the Beast offering (forcing) all to take of his altered genetic material – Satan will be perfectly imitating our salvation. Probably one reason people will desire to take of his seed is because of the powers they are promised. We have seen both in the movies and by real life personal testimony the “aliens” appear as beings of light. Of course, believers in Jesus will actually receive true bodies of light – but the Beast will promise glorious bodies which he will ultimately not deliver. However, those transformed with the DNA change (Mark of the Beast) will receive traits of Satan – possibly being that they will not be able to die which we see when the locusts torment mankind for five months and thought they seek death but it will flee from them (Revelation 9:6) – this could be because they possess traits from Satan (who does not die).
Who's Interested in Optogenetics?
With the roll out of the White House's $300 million BRAIN Initiative in 2013, interest in uncovering the secrets of the human brain has accelerated and now includes many government agencies, public/private partnerships and universities.
Dating back to at least 1971, optogenetic research has matured enough to gain the attention of organizations such as the NIH, DARPA and IARPA, who are exploring the role that light-sensitive cells could soon play in fields surrounding neurobiological, including physical and mental health, human-machine interfacing, and advancing artificial intelligence through reverse brain engineering.
How Does Optogenetics Work?
Current optogenetic experiments rely on extracting "opsins" (light-sensitive proteins) from plants which can be introduced to mammals by methods including injection and infection via adenovirus.
Once delivered into an organism, opsins can be expressed in eye, brain or skin cells, allowing their light-sensitivity to be remotely activated or silenced with timed pulses of light in different color wavelengths across the light spectrum that can target multiple bodily systems and cause a variety of biological effects.
Current Capabilities and Interests
As part of the BRAIN Initiative, scientists have been working on neuronal barcoding and completing a detailed online brain atlas for researchers. This is hoped to eventually provide a detailed circuit diagram of every neuron and synapse in the brain, which would allow various neuronal patterns to be identified so they can be triggered for the desired effect.
If targeted precisely enough with the appropriate light, it's thought that optogenetics could be used by manipulating neural circuits involved with pain, fear, reward, wakefulness and social behaviors. In one Yale study, for example, mice were infected with a virus which made their neurons sensitive to blue light. Scientists then used that light pathway to activate predatory behavior.
"...The researchers used a tiny optic fibre to shine a blue laser on the amygdala. This prompted the animals to tense their jaw and neck muscles... 'It's not just physiological, it's hunting, biting, releasing and eating. Those are motor sequences that require a lot of information...' [said an MIT neuroscientist]"
In 2015, optogenetics was combined with CRISPR to develop a set of photoactivatable tools that enable the editing of an organism's genome through the external use of light. Said tools can control the location, timing and reversibility of the genome editing process, whether that be activating, repressing or modifying a gene.
Optogenetics is also mentioned as an integral feature of the DARPA-funded Neural Engineering System Design (NESD) program, a joint effort between six teams who are aiming to create an implantable neural interface over the next four years that is capable of high resolution brain-to-machine communication. Such advancements, for instance, could facilitate the development of mind-controlled prosthetics featuring touch sensation like the DARPA-backed 'Luke' arm (previously known as the 'Deka' arm).
Clinical Trial and Future Technologies
Companies interested in the application of optogenetic technologies have begun emerging over the last decade, particularly since the FDA approved the technology in 2015 for use in treating an eye disorder known as "retinitis pigmentosa."
The approval prompted a clinical trial and optogenetic developments have since been used to restore partial vision in patients who were described as being "profoundly blind." Chronic pain management, epilepsy and Parkinson's are among many health issues that researchers are experimenting with addressing through optogenetics. The technology is also contributing to other areas of research such as "sonogenetics," which uses low-pressure ultrasound to activate ultrasonically sensitized neurons. This is another area of interest for DARPA, which has funded Columbia University's endeavor to stimulate neurons using ultrasound and believes it could eventually lead to a magnetic version of the technology called "magnetogenetics."
To investigate the therapeutic use of optogenetics, acoustics and electromagnetic fields, DARPA launched the ElectRX (Electrical Prescription) program in 2015, which is capable of stimulating, modulating and monitoring the body's peripheral nervous system. The research agency is also exploring how artificial intelligence could be used in closed-loop brain implants, such as the ability to detect patterns associated with mood disorders.
With enough progress, it's believed that optogenetics and its surrounding bodies of research may open the door to real-time brain mapping and biofeedback technologies, which could be used to treat all manner of ailments on the fly through closed-loop neuromodulation signals coming to and from an implanted device, ultimately eliminating the need for pharmaceuticals.
DARPA, the Defense Research Projects Agency, is perhaps best known for its role as progenitors of the computer networking and the Internet. Formed in the wake of the Soviet Union’s surprise launch of Sputnik, DARPA’s objective was to ensure that the United States would avoid technological surprises in the future. This role was later expanded to causing technological surprises as well.
And although DARPA is and has been the leading source of funding for artificial intelligence and a number of other transhumanist projects, they’ve been missing in action for a while. Nothing DARPA has worked on since seems to have had the societal impact of the invention of the Internet. But that is about to change.
The current director of DARPA is Dr. Arati Prabhakar. She is the second female director of the organization, following the previous and controversial director Regina Dugan who left the government to work at Google. The return to big visions and big adventures was apparent and in stark contrast to Dugan’s leadership of the organization.
Quoted in WIRED, Dugan had, for example, stated that “There is a time and a place for daydreaming. But it is not at DARPA,” and she told a congressional panel in March 2011, “Darpa is not the place of dreamlike musings or fantasies, not a place for self-indulging in wishes and hopes. DARPA is a place of doing.”
Those days are gone. DARPA’s new vision is simply to revolutionize the human situation and it is fully transhumanist in its approach.
The Biological Technologies Office or BTO was announced with little fanfare in the spring of 2014. This announcement didn’t get that much attention, perhaps because the press release announcing the BTO was published on April Fool’s Day.
But DARPA is determined to turn that around, and to help make that happen, they held a two day event in the SIlicon Valley area to facilitate and communicate about radical changes ahead in the area of biotechnologies. Invitees included some of the top biotechnology scientists in the world. And the audience was a mixed group of scientists, engineers, inventors, investors, futurists, along with a handful of government contractors and military personnel.
Biology is Technology
I was lucky to be invited to this event because although I spend a large amount of time researching technology and science as related to the future, nothing prepared me for the scope of the DARPA vision. The ostensible purpose of the two day meeting was to introduce the DARPA Biotechnology Program Office and to connect program managers with innovators, investors, and scientists working in biotechnology and related disciplines. But really they were here to shake things up.
The first Program Manager to present, Phillip Alvelda, opened the event with his mind blowing project to develop a working “cortical modem”. What is a cortical modem you ask? Quite simply it is a direct neural interface that will allow for the visual display of information without the use of glasses or goggles. I was largely at this event to learn about this project and I wasn’t disappointed.
Leveraging the work of Karl Deisseroth in the area of optogenetics, the cortical modem project aims to build a low cost neural interface based display device. The short term goal of the project is the development of a device about the size of two stacked nickels with a cost of goods on the order of $10 which would enable a simple visual display via a direct interface to the visual cortex with the visual fidelity of something like an early LED digital clock.
The implications of this project are astounding.
Consider a more advanced version of the device capable of high fidelity visual display. First, this technology could be used to restore sensory function to individuals who simply can’t be treated with current approaches. Second, the device could replace all virtual reality and augmented reality displays. Bypassing the visual sensory system entirely, a cortical modem can directly display into the visual cortex enabling a sort of virtual overlay on the real world. Moreover, the optogenetics approach allows both reading and writing of information. So we can imagine at least a device in which virtual objects appear well integrated into our perceived world. Beyond this, a working cortical modem would enable electronic telepathy and telekinesis. The cortical modem is a real world version of the science fiction neural interfaces envisioned by writers such as William Gibson and more recently Ramez Naam.
To the extent that it is real, the cortical modem is still a crude device. This isn’t going to give you a high fidelity augmented reality display soon. And since the current approach is based in optogenetics, it requires a genetic alteration of the DNA in your neurons. The health implications are unknown, and this research is currently limited to work with animal models. Specifically discussed was a real time imaging of the zebrafish brain with about 85,000 neurons.
Notably, while i was live blogging the event one h+ Magazine reader volunteered to undergo this possibly dangerous genetic procedure in exchange for early access to a cortical modem. A fact which I later got to mention directly to Dr. Prabhakar at the reception afterwards.Following the astounding cortical modem presentation, Dr. Dan Wattendorf presented DARPA’s efforts to get in front of and prevent disease outbreaks such as the recent crisis with ebola in Africa. This was a repeated theme throughout the event. DARPA is clearly recognizing the need to avoid “technological surprises” from nature as well as from nations. It is widely recognized that the current technology for dealing with novel disease outbreaks, the so called “post antibiotic” era, and bioweapons requires entirely new strategies for detection and rapid response to communicable illnesses. As an example, the ebola vaccine currently being considered for use has been in development for decades. Moreover, only a small number of vaccines exists even for known diseases. A novel threat might provide only weeks or months to respond however. Clearly new approaches are needed in both detection of disease outbreaks and response to them. Perhaps most interesting to me here was the discussion of transient gene therapies where an intervention that alters an organism’s DNA but which “turn off” after some time period or event.
Several different DARPA performers also gave presentations. These are the people that DARPA has hired under contract to actually do the work and the presentations were a pretty heady and eclectic mix ranging from deep science to the unusual and on to the profound. Dr.Michel M. Maharbiz of UC Berkeley who is developing “neural dust” and has done controversial work with insect cyborgs. Saul Griffith of Otherlab presented the farthest ranging talk including his work with computer controlled inflatables which includes development of exoskeleton concepts, pneumatic sun trackers for low cost solar power applications, and a life sized robotic inflatable elephant he made for his daughter. I was also intrigued by a toy they had designed that was a universal constructor. He also had some very interesting analysis of the world’s energy production and utilization, showing areas where DARPA (and anyone else interested) could make the biggest difference to slow climate change.
How about curing all known and even unknown communicable diseases? Exploring “post pathogen medicine” is an effort in which DARPA is working to identify “unlikely heros”, those individuals with surprising resilience or resistance to dangerous diseases. The idea is to apply big data analytics to analyze data from a large number of existing scientific analyses that might hide data indicating genetic markers for immunity or disease resistance in individuals.
Karl Deisseroth presented his work with optogenetics and his newer techniques for transforming neural tissue into a clear gel that can be imaged. He presented some impressive images from this work and his new unpublished imaging technique called “Swift 3D”. The resulting images are real-time maps of neural events. For example, Dr. Deisseroth presented visual representations of mouse thoughts from one controlled experiment.
Beyond reading mids, DARPA’s BiT programs are also looking to revolutionize the practice of biology and science in general. Dr. Stephen Friend presented Sage Networks a science oriented social sharing and collaboration platform which radically realigns the practices of scientific publication and data sharing. Apart from providing a standardized platform for publishing annotated bioscience datasets, the system requires users to make their data available to other researchers while still preserving their ability to get credit for original ideas and work. This project is important and could see application elsewhere outside of the biosciences. One member of the audience was so impressed with this idea she was compelled to comment.
More directly, DARPA seeks to revolutionize the day to day practice of biotechnology and drug development. A series of “organs on a chip” was presented. These devices allow cultures of cells from an individual’s organs to be grown and treated with medications to assess effectiveness and possible side effects without the need to use an animal model or test on a live human subject. While they haven’t replicated every human organ, they did have a “gut on a chip” shown here. These little chips are flexible and kind of artistic actually. The company Emulate had a representative explaining the technology at the reception after the first day of the event. This is just one of several projects in which DARPA is seeking to understand the effects of drugs including adverse side effects in novel ways. The eventual hope is to shorten time to market while also radically lowering the costs of new medications.
Microfluidics — making tiny droplets
Another impressive series of developments was presented in the area of microfluidics. These developments consist of a set of technologies for creating very small droplets, and various mechanisms for manipulating, and experimenting on these tiny drops. Currently the practice of bioscience experimentation is largely performed by human postdocs who spend thousands of hours pipetting, mixing, and carefully measuring results. But using microfluidics and a series of intricate valves, nozzles, and so on, many of these procedures can be automated and radically sped up.
The audience got a chance to mix with the DARPA program managers after the event at a reception where some of DARPA’s projects were presented in a hands on environment. I had a brief conversation with Dr. Prabhakar who mentioned that she was aware of Humanity+ and transhumanism more generally. She was excited to have us involved, but also expressed some dismay at the political aspect of the transhumanist movement.
All this highlights the power of the virus which, despite having a mortality rate now around 2% and therefore lower than the respiratory tract syndromes SARS (7%), has a contagious rapidity in some tragically high and, above all, unstoppable areas. It is a viral strain of the large CoronaVirus family: that of simple “common cold”, the upper respiratory tract disorder including cold, cough, maldigola, which, however, can degenerate into pneumonia so severe as to paralyze the lungs thus blocking the blood oxygenation.
The International Committee on Taxonomy of Viruses (ICTV) has already renamed it Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) given its dangerousness already attested in a detailed article published by some Chinese scientists in the February issue of “Science China Life Sciences ”which highlights biochemical anomalies such as to induce the Chinese Communist Party to consider it without a shadow of a doubt a biological weapon.
According to other American experts, it is a war instrument that got out of hand in Wuhan, Chinese second and independent analysts were built and spread by some enemy of Beijing. Among the number one suspects are the United States that all over the world, especially in the countries bordering Russia, China, and the Middle East, have at least 25 laboratories for the production of biogenetic weapons, that is, calibrated on the genome of some ethnic groups. And some 007 confirm that it is a widespread epidemic with nano-drones …
In addition to having started studies on the genetic manipulation of insects such as viral vehicles as defense or attack tools (officially against pests in agriculture), the US has already created DragonflEye, the light-guided cyber-dragonfly for reconnaissance flights, targeted pollination and delivery of “payload”. We will see later in detail the Pentagon partner laboratories that developed the project, started by the CIA in 1970 with the first Insecthoper.
This was the first prototype of “nano-drone” which has also evolved today in the Black Hornet 3, the 10 cm UAV helicopter already in use by the American army and other NATO countries, whose kit can fit in a military backpack. Or a tourist visiting a foreign country…
CHINA AND IRAN: MORE DEATHS IN US ENEMY COUNTRIES
The increase in the number of deaths and infected with COVID-19 (where “CO” stands for corona, “VI” for virus, “D” for disease and “19” indicates the year in which it occurred), as called by the Director-General of the World Health Organization Tedros Adhanom Ghebreyesus on February 11, 2020, it is so dizzying that now no health institution or media in the world is able to provide a real-time update, therefore, the data we are reporting will already be exceeded half now after publication.
As posted by Gospa News, the reporter, the first in the world to discover the conventional weapons delivered by the CIA to ISIS terrorists before the Turkish SETA dossier revealed all the jihadist formations supplied with TOW missiles by the American counterintelligence agency, discovered the existence of research in the field of bio-genetics in reference to the Chinese and Russian genomes.
PROTEIN “MODELED” FOR BECOMING AGGRESSIVE
Well, the suspicions of biogenetic manipulation of Gaytandzhieva, a member of Brown’s Bioweapon Truth Commission mentioned above, are now partially confirmed in scientific research disclosed by a video by some exponents of the Chinese Communist Party (CPP) that the Sino-English dual language site GNews (close to communication expert Stephen Bannon, former coordinator of Donald Trump’s winning election campaign) translated from the original language.
«On January 21st, three researchers from the Chinese Academy of Sciences published a joint paper in the “Science China Life Sciences” journal, written in English. They revealed the truth about the novel coronavirus, so please watch this news closely» reads.
There were three researchers who found this information — Pei Hao, a researcher from Institute Pasteur of Shanghai and the Chinese Academy of Sciences, Wu Zhong, a researcher from National Engineering Research Center for the Emergence Drugs, Academy of Military Medical Sciences, and Xuan Li, a researcher from Key Laboratory of Synthetic Biology, CAS Center for Excellence in Molecular Plant Sciences.
The researchers were shocked when they compared the SARS S-protein with Wuhan CoV’s S-protein and found that it doesn’t alter the structural composition of the virus even though four amino acids were replaced.
This research points to an important discovery that the Wuhan CoV S-protein supports strong interaction with human ACE2 molecules, which can lead to infecting the epithelial cells in the upper respiratory tract. This discovery also told us that Wuhan CoV is highly contagious by design. This research has laid a theoretical foundation for China to develop control, test, and intervention of Wuhan CoV in a scientific way. After reading the research report, people are outraged in disbelief. The key point of all these findings is that “four of the important S-protein have been replaced in Wuhan Coronavirus”.
First, the purpose is to disguise Wuhan CoV as SARS to make it more difficult for medical researchers and doctors to differentiate it from SARS. This misleads them into taking SARS-like prevention measures, which can result in the delay of treatment and increased spread of the virus. Secondly, it is so contagious that it spreads rapidly by design – further Chinese Communist Party blamed – Can this type of crime through biotechnology against humanity being committed by bats or bamboo rats? Ten thousand years of evolution cannot produce this type of precise altering of four important S-proteins! The fact that the Wuhan virus was created in a lab under human influence Is indisputable. This is inhumane to the extreme».
In 2010, China won the battle against the SARS virus. In 2015, the PLA hospital won battles against the Ebola virus in Africa. This time, our enemy picked Chinese New Year for a new viral outbreak. We are facing a new challenge. All medical research and epidemic prevention personnel in our country have entered a war-ready state. All the people in the country are on high alert and are combat-ready. The Chinese people will win this war added CCP.
The researchers in the synthetic document called ” Evolution of the novel coronavirus from the ongoing Wuhan outbreak and modeling of its spike protein for risk of human transmission” published in the scientific journal as “letter to the editor” are more cautious but highlight the same concerns.
According to the crystal structure of SARS-CoV S-protein RBD domain complexed with its receptor ACE2 (PDB code: 2AJF), the 3-D complex structure of the Wuhan CoV S protein binding to human ACE2 was modeled with structural superimposition and molecular rigid docking – biochemical doctors wrote – So to our surprise, despite replacing four out of five important interface amino acid residues, the Wuhan CoV S-protein was found to have a significant binding affinity to human ACE2. Looking more closely, the replacing residues at positions 442, 472, 479, and 487 in the Wuhan CoV S-protein did not alter the structural conformation.
In summary, our analysis showed that the Wuhan CoV shared with the SARS/SARS-like coronaviruses a common ancestor that resembles the bat coronavirus HKU9-1. Our work points to the important discovery that the RBD domain of the Wuhan CoV S-protein supports strong interaction with human ACE2 molecules despite its sequence diversity with SARS-CoV S-protein. Thus the Wuhan CoV poses a significant public health risk for human transmission via the Sprotein–ACE2 binding pathway.
“FIVE EYES” VACCINE SUDDENLY READY…
American researchers try to dismantle the hypothesis of a laboratory virus in the discussion with various profiles on the specialized Virologica.org site where the debate is focused on the genome and its animal origin (the genetic profile is close to 99% to that of a virus grown in the Malaysian pangolin). One of these scientists, at the end of his digression in which he categorically excludes human manipulation with quirky biochemical arguments, thanks Wellcome Trust for the contribution.
This shows an evident relationship with one of the main financiers on the experiments on the CoronaVirus family before the epidemic. As reported in the previous article, in fact, this foundation was born after the transformation of the American pharmaceutical holding Wellcome taken over by the Glaxo SmithKline group, the notorious GSK, leader in the production of vaccines in the world but also repeatedly investigated and convicted of countless criminal violations on the subject of corruption and health laws, already formally charged with contributing to the search for a vaccine together with the Australian University of Queensland (see previous article).
According to the last news, in record time, the Australian vaccine would have already passed the first tests and its experimentation on animal guinea pigs would have already begun. It must not be forgotten that the intelligence of Australia SIS is part of the international group of secret services of the so-called “Five Eyes” together with the USA, the United Kingdom, Canada, and New Zealand.
Therefore the patent of a new vaccine by the Australians with the help of the British big pharma GSK which is a partner of the Darpa agency of the Pentagon in multiple projects is certainly another reason for suspicion …
Wellcome Trust is instead among the financiers of the Pirbright Institute depositary of patent no. 10130701 in the USA for a ConoraVirus research on avian chickens. The name of this British research center is mentioned in the context of the radio conversation between American journalists Kevin Barrett and Jeff Brown.
«Well, you know, I think people need to understand that the Ebola virus is owned by, patented by the U.S. military. The Zika virus is patented by the Rockefeller Foundation. I just learned that the coronavirus, our favorite friend these last four weeks, is patented by the Pirbright Institute, which is funded by Bill Gates».
DragonflEye is a genetically modified dragonfly with light-sensitive “steering neurons” implanted in its spinal cord. Insects fitted with a custom backpack filled with sensors are capable of being controlled, but it’s still in development. Flashes of light are used to make the insects fly or move» reads on the same website.
It now appears that the project overcame the first hurdle after some of the genetically modified dragonflies took their first flight. The idea was developed by researchers from the Charles Drak Stark Laboratory and the Howard Hughes HHMI Medical Institute, which specializes in biomedical research and partners in various DARPA projects. In the summer of 2017, their first positive tests had great visibility in the media and on YouTube also with the interview with the researchers.
This system pushes the boundaries of energy harvesting, motion sensing, algorithms, miniaturization and optogenetics, all in a system small enough for an insect to wear J. Wheeler, a biomedical engineer at Draper and Howard Hughes Medical Institute and principal investigator of the technology said in a press release, according to Us TomoNews.
The cyborg dragonflies could be turned into tiny surveillance systems. Other applications of this technology may include guided pollination, payload delivery, and precision medicine and diagnostics is specified.
For two years now nothing has been known about DragonflEye and its possible use in the military field given the consolidated collaboration between the Hughes Institute and the Pentagon. However, it is clear that if a dragonfly can be genetically modified and remotely controlled for pollination in the same way, it can be easily piloted for the spread of a virus.
Comments